Pedido rápido

Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano CAPN5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004055.4
Tamaño de cDNA:1923bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens calpain 5 with N terminal His tag.
Sinónimo de gen:HTRA3, nCL-3, FLJ46245, CAPN5
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CAPN5 qPCR primers for gene expression analysis, HP101267 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11390-ACG$245
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11390-ACR$245
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11390-ANG$245
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11390-ANR$245
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11390-CF$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11390-CH$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11390-CM$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11390-CY$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(Vector de expresión)HG11390-M$75
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11390-NF$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11390-NH$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11390-NM$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11390-NY$215
Humano Calpain 5/CAPN5 clonación del ADN o clonación génica(vector de clonación)HG11390-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11390-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"