Pedido rápido

Text Size:AAA

Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CAT Información de producto de clon de cDNA
Tamaño de cDNA:1584bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens catalase with C terminal HA tag.
Sinónimo de gen:MGC138422, MGC138424, CAT
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12084-ACG$245
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12084-ACR$245
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12084-ANG$245
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12084-ANR$245
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12084-CF$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12084-CH$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12084-CM$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12084-CY$215
Humano CAT/Catalase clonación del ADN o clonación génica(Vector de expresión)HG12084-G$75
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación)HG12084-G-N$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12084-NF$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12084-NH$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12084-NM$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12084-NY$215
Humano CAT/Catalase clonación del ADN o clonación génica(vector de clonación)HG12084-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Catálogo: HG12084-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.