Pedido rápido

Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

  • Human bFGF/FGF2 Gene Plasmid Map 5639
Hoja de datosReseñasProductos relacionadosProtocolos
Humano CBLB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_170662.3
Tamaño de cDNA:2994 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens Cas-Br-M (murine) ecotropic retroviral transforming sequence b with N terminal Myc tag.
Sinónimo de gen:RNF56, FLJ36865, FLJ41152, Nbla00127, DKFZp779A0729, DKFZp779F1443, DKFZp686J10223, CBLB
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:pCMV3-Myc-CBLB
Sitio de restricción:KpnI + XbaI(6kb+2.99kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1317C/T,1386A/C,2658T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CBLB qPCR primers for gene expression analysis, HP101312 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11435-ACG$325
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11435-ACR$325
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11435-ANG$325
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11435-ANR$325
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11435-CF$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11435-CH$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11435-CM$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11435-CY$295
Humano CBLB Gene cDNA clone plasmidHG11435-M$75
Humano CBLB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11435-M-F$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación)HG11435-M-N$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11435-NF$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11435-NH$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11435-NM$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11435-NY$295
Humano CBLB clonación del ADN o clonación génica(vector de clonación)HG11435-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11435-NM
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"