Pedido rápido

Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano ENG Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001114753.1
    Tamaño de cDNA:1977bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens endoglin (ENG), transcript variant 1 with N terminal Myc tag.
    Sinónimo de gen:Eng, END, ORW, HHT1, ORW1, CD105, FLJ41744
    Especie:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ENG qPCR primers for gene expression analysis, HP100220 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10149-ACG$245
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10149-ACR$245
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10149-CF$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10149-CH$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10149-CM$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10149-CY$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10149-M$75
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10149-M-N$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10149-NF$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10149-NH$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10149-NM$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10149-NY$215
    Humano Endoglin/CD105 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10149-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"