After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human VCAM1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001078.2
Tamaño de cDNA:2220bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 with N terminal His tag.
Sinónimo de gen:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10113-ACG$245
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10113-ACR$245
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10113-CF$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10113-CH$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10113-CM$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10113-CY$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10113-M$75
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10113-M-N$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10113-NF$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10113-NH$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10113-NM$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10113-NY$215
Humano VCAM1/VCAM-1/CD106 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10113-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

Referencias
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Catálogo: HG10113-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"