After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PVR Información de producto de clon de cDNA
Tamaño de cDNA:1254bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens poliovirus receptor (PVR),transcript variant 1 with N terminal His tag.
Sinónimo de gen:CD155, PVS, HVED, PVR, NECL5, TAGE4, Necl-5
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10109-ACG$225
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10109-ACR$225
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10109-CF$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10109-CH$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10109-CM$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10109-CY$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10109-M$75
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10109-NF$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10109-NH$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10109-NM$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10109-NY$195
Humano CD155/PVR transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10109-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.

  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.
  • Size / Price
    Catálogo: HG10109-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.