Pedido rápido

Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CD226 Información de producto de clon de cDNA
    Tamaño de cDNA:1011bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens CD226 molecule with N terminal Flag tag.
    Sinónimo de gen:PTA1, DNAM1, DNAM-1, TLiSA1
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    ( We provide with CD226 qPCR primers for gene expression analysis, HP100575 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10565-ACG$225
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10565-ACR$225
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10565-CF$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10565-CH$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10565-CM$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10565-CY$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(Vector de expresión)HG10565-M$75
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10565-M-F$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación)HG10565-M-N$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10565-NF$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10565-NH$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10565-NM$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10565-NY$195
    Humano CD226/DNAM-1/PTA1 clonación del ADN o clonación génica(vector de clonación)HG10565-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD226, also known as PTA1 or DNAM-1, is a member of the immunoglobulin superfamily containing 2 Ig-like domains of the V-set. High rate of CD226 (Cluster of Differentiation 226) is found on the surface of natural killer cells, platelets, monocytes and a subset of T cells. CD226 have binding sites with CD112 and CD155 and mediate cellular adhesion to other cells containing its ligands.

    Immune Checkpoint
    Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: FCM Antibodies
    Immune Checkpoint Proteins
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Size / Price
    Catálogo: HG10565-NF
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.