After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human IL2RA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000417.1
Tamaño de cDNA:819bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 2 receptor, alpha (IL2RA) with N terminal Myc tag.
Sinónimo de gen:IL2RA, CD25, IL2R, TCGFR, IDDM10
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10165-ACG$225
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10165-ACR$225
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10165-CF$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10165-CH$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10165-CM$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10165-CY$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(Vector de expresión)HG10165-M$75
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10165-M-H$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10165-NF$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10165-NH$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10165-NM$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10165-NY$195
Humano IL2RA/IL-2RA/CD25 clonación del ADN o clonación génica(vector de clonación)HG10165-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.

Referencias
  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.
  • Size / Price
    Catálogo: HG10165-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"