After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CD276 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001024736.1
Tamaño de cDNA:1605bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens CD276 molecule transcript variant 1.
Sinónimo de gen:B7H3, B7-H3, CD276
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CD276
Sitio de restricción:KpnI + XbaI (6.1kb + 1.61kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CD276 Gene Plasmid Map
Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11188-ACG$245
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11188-ACR$245
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11188-CF$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11188-CH$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11188-CM$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11188-CY$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11188-M$75
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11188-M-F$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11188-NF$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11188-NH$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11188-NM$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11188-NY$215
Humano B7-H3/CD276 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11188-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

Referencias
  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.
  • Size / Price
    Catálogo: HG11188-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"