After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CD68 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001251.2
Tamaño de cDNA:1065bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens CD68 molecule, transcript variant 1.
Sinónimo de gen:GP110, SCARD1, DKFZp686M18236, CD68
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CD68
Sitio de restricción:KpnI + XbaI (6.1kb + 1.07kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CD68 Gene Plasmid Map
Human CD68 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11192-ACG$225
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11192-ACR$225
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11192-CF$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11192-CH$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11192-CM$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11192-CY$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11192-M$75
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11192-M-F$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11192-NF$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11192-NH$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11192-NM$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11192-NY$195
Humano CD68 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11192-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

Referencias
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Catálogo: HG11192-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"