After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CD84 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003874.1
Tamaño de cDNA:987bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens CD84 molecule with N terminal His tag.
Sinónimo de gen:LY9B, hCD84, mCD84, SLAMF5, DKFZp781E2378
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10100-ACG$225
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10100-ACR$225
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10100-CF$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10100-CH$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10100-CM$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10100-CY$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10100-M$75
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10100-M-F$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10100-NF$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10100-NH$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10100-NM$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10100-NY$195
Humano CD84 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10100-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

Referencias
  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    Catálogo: HG10100-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"