After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CD8/CD8 alpha/Leu-2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CD8A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001768.5
Tamaño de cDNA:708bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens CD8a molecule with C terminal Flag tag.
Sinónimo de gen:CD8, MAL, p32, Leu2
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano CD8/CD8 alpha/Leu-2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Product nameProduct name
Fondo

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

Referencias
References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.
Size / Price
Catálogo: HG10980-CF
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"