Pedido rápido

Text Size:AAA

Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDC16 Información de producto de clon de cDNA
Tamaño de cDNA:1863bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cell division cycle 16 homolog (S. cerevisiae) with C terminal His tag.
Sinónimo de gen:APC6, CDC16
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11105-ACG$245
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11105-ACR$245
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11105-ANG$245
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11105-ANR$245
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11105-CF$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11105-CH$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11105-CM$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11105-CY$215
Humano CDC16/APC6 clonación del ADN o clonación génica(Vector de expresión)HG11105-M$75
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11105-M-F$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11105-NF$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11105-NH$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11105-NM$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11105-NY$215
Humano CDC16/APC6 clonación del ADN o clonación génica(vector de clonación)HG11105-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11105-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.