Pedido rápido

Humano CDC27 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CDC27 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC011656
    Tamaño de cDNA:2493bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens cell division cycle 27 with N terminal His tag.
    Sinónimo de gen:APC3, HNUC, NUC2, ANAPC3, CDC27Hs, D0S1430E, D17S978E
    Especie:Human
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CDC27 qPCR primers for gene expression analysis, HP104557 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano CDC27 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Product nameProduct name
    Fondo

    Cdc27, a component of the anaphase-promoting complex (APC/C), as a novel binding partner of MCPH1. APC/C is an E3 ubiquitin ligase that controls the cell cycle. A combination of in vitro and in vivo experiments revealed that the interaction between MCPH1 and Cdc27 is dependent on the phosphorylation of Cdc27 and is mediated by the C-terminal BRCT domains of MCPH1.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Singh N, Wiltshire TD, Thompson JR, Mer G, Couch FJ. Molecular Basis for the Association of Microcephalin (MCPH1) Protein with the Cell Division Cycle Protein 27 (Cdc27) Subunit of the Anaphase-promoting Complex. The Journal of Biological Chemistry. 2012;287(4):2854-2862.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"