After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDH13 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001257.3
Tamaño de cDNA:2142bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cadherin 13,H-cadherin(heart) with C terminal Myc tag.
Sinónimo de gen:CDHH,
Especie:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-CDH13-Myc
Sitio de restricción:KpnI+XbaI (6kb+2.19kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2076A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CDH13 Gene Plasmid Map
Human CDH13 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11249-ACG$245
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11249-ACR$245
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11249-CF$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11249-CH$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11249-CM$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11249-CY$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(Vector de expresión)HG11249-M$75
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11249-NF$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11249-NH$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11249-NM$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11249-NY$215
Humano CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación)HG11249-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

Referencias
  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catálogo: HG11249-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"