Pedido rápido

Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CDH6 Información de producto de clon de cDNA
    Tamaño de cDNA:1992bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) with N terminal Myc tag.
    Sinónimo de gen:CDH6, KCAD
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with CDH6 qPCR primers for gene expression analysis, HP100221 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10150-ACG$245
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10150-ACR$245
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10150-CF$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10150-CH$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10150-CM$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10150-CY$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(Vector de expresión)HG10150-M$75
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10150-M-F$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación)HG10150-M-N$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10150-NF$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10150-NH$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10150-NM$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10150-NY$215
    Humano Cadherin-6/CDH6 clonación del ADN o clonación génica(vector de clonación)HG10150-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name

    Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • Size / Price
    Catálogo: HG10150-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.