Pedido rápido

Human CDH8 ORF mammalian expression plasmid, N-Myc tag

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDH8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001796.2
Tamaño de cDNA:2400bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cadherin 8, type 2 (CDH8) with N terminal Myc tag.
Sinónimo de gen:CDH8, Nbla04261
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fondo

Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of five subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I  cadherins. Cadherin 8, also known as CDH 8, is a type I I classical cadherin belonging to the cadherin superfamily. As mainly expressed in brain, CDH8 is found in certain nerve cell lines, such as retinoblasts, glioma cells and neuroblasts, and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Human Cadherin 8 is a 799 amino acid single-pass type I  transmembrane protein with a putative 29 aa signal sequence, and a 32 aa propeptide, a 560 aa mature extracellular domain, a 21 aa transmembrane domain and a 157 aa cytoplasmic domain. The human, mouse and rat proteins share approximately 98% homology.

Referencias
  • Tanihara, H. et al., 1994, Cell Adhes. Comm. 2:15-26.
  • Kido, M. et al., 1998, Genomics 48:186-194.
  • Yamagata, K. et al., 1999, J. Biol. Chem. 274:19473-19479.
  • Nollet, F. et al., 2000, J. Mol. Biol. 299:551-572.
  • Blaschke, S. et al., 2002, Int. J. Cancer. 101 (4): 327-334.
  • Strausberg,R.L. et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 99 (26): 16899–16903.
  • Size / Price
    Catálogo: HG10144-NM
    Precio de lista:   (Save )
    Precio:      [How to order]
    Disponibilidad
     Instrucciones de envío
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"