After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CDKL2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDKL2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003948.3
Tamaño de cDNA:1482bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase).
Sinónimo de gen:P56, KKIAMRE, CDKL2
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CDKL2
Sitio de restricción:HindIII + XbaI (6.1kb + 1.48kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CDKL2 Gene Plasmid Map
Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11191-ACG$225
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11191-ACR$225
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11191-ANG$225
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11191-ANR$225
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11191-CF$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11191-CH$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11191-CM$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11191-CY$195
Humano CDKL2 clonación del ADN o clonación génica(Vector de expresión)HG11191-M$75
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11191-M-F$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11191-NF$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11191-NH$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11191-NM$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11191-NY$195
Humano CDKL2 clonación del ADN o clonación génica(vector de clonación)HG11191-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

Referencias
  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.
  • Size / Price
    Catálogo: HG11191-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"