Pedido rápido

Text Size:AAA

Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDKN1A Información de producto de clon de cDNA
Tamaño de cDNA:495bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) with C terminal His tag.
Sinónimo de gen:P21, CIP1, SDI1, WAF1, CAP20, CDKN1, MDA-6, p21CIP1, CDKN1A
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11108-ACG$225
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11108-ACR$225
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11108-ANG$225
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11108-ANR$225
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11108-CF$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11108-CH$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11108-CM$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11108-CY$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(Vector de expresión)HG11108-M$75
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11108-NF$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11108-NH$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11108-NM$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11108-NY$195
Humano p21/WAF1/CDKN1A clonación del ADN o clonación génica(vector de clonación)HG11108-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11108-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.