Pedido rápido

Text Size:AAA

Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CDKN1B Información de producto de clon de cDNA
Tamaño de cDNA:597bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) with C terminal His tag.
Sinónimo de gen:KIP1, MEN4, CDKN4, MEN1B, P27KIP1, CDKN1B
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11109-ACG$225
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11109-ACR$225
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11109-ANG$225
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11109-ANR$225
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11109-CF$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11109-CH$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11109-CM$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11109-CY$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(Vector de expresión)HG11109-M$75
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11109-NF$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11109-NH$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11109-NM$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11109-NY$195
Humano p27/Kip1/CDKN1B clonación del ADN o clonación génica(vector de clonación)HG11109-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11109-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.