Pedido rápido

Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CDKN2B Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_004936.3
    Tamaño de cDNA:417bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) with C terminal His tag.
    Sinónimo de gen:P15, MTS2, TP15, CDK4I, INK4B, p15INK4b
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CDKN2B qPCR primers for gene expression analysis, HP101018 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11103-ACG$225
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11103-ACR$225
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11103-ANG$225
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11103-ANR$225
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11103-CF$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11103-CH$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11103-CM$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11103-CY$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(Vector de expresión)HG11103-M$75
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11103-M-F$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11103-NF$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11103-NH$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11103-NM$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11103-NY$195
    Humano CDKN2B/p15 INK4b clonación del ADN o clonación génica(vector de clonación)HG11103-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG11103-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"