CDX2 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

CDX2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Human caudal type homeobox 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDX2 cDNA ORF Clone, Human, N-HA tag: Alternative Names

CDX-3 cDNA ORF Clone, Human; CDX2/AS cDNA ORF Clone, Human; CDX3 cDNA ORF Clone, Human

CDX2 Background Information

CDX2 is a transcription factor that acts as a tumor suppressor in colorectal cancer (CRC). CDX2 is a homeobox gene encoding transcriptional factors for intestinal organogenesis and represents a specific marker of colorectal adenocarcinoma (CRC) differentiation.Its loss triggers metastatic process and tumor progression. CDX2 stimulates porcine intestinal epithelial cell proliferation by activating the mTORC1 and Wnt/beta-catenin signaling pathways. Overexpression of CDX2 is a reliable biomarker of a better prognosis in solid malignancies. Caudal-related homeobox transcription factor 2 (CDX2) has recently been proposed as a prognostic factor for gastric carcinoma.
Full Name
caudal type homeobox 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait