After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CES3 Información de producto de clon de cDNA
Tamaño de cDNA:1716bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carboxylesterase 3 with C terminal His tag.
Sinónimo de gen:ES31, FLJ21736, CES3
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11129-ACG$245
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11129-ACR$245
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11129-CF$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11129-CH$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11129-CM$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11129-CY$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(Vector de expresión)HG11129-M$75
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11129-M-F$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11129-NF$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11129-NH$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11129-NM$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11129-NY$215
Humano CES3/Carboxylesterase 3 clonación del ADN o clonación génica(vector de clonación)HG11129-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    Catálogo: HG11129-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.