Pedido rápido

Text Size:AAA

Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CFL1 Información de producto de clon de cDNA
Tamaño de cDNA:501bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cofilin 1 (non-muscle) with N terminal Flag tag.
Sinónimo de gen:CFL
Sitio de restricción:KpnI + XbaI (6kb + 0.55kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CFL1 Gene Plasmid Map
Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14544-ACG$225
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14544-ACR$225
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14544-ANG$225
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14544-ANR$225
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14544-CF$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14544-CH$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14544-CM$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14544-CY$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(Vector de expresión)HG14544-G$75
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14544-NF$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14544-NH$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14544-NM$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14544-NY$195
Humano CFL1 / cofilin clonación del ADN o clonación génica(vector de clonación)HG14544-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • Size / Price
    Catálogo: HG14544-NF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.