Pedido rápido

Text Size:AAA

Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano CHAT Información de producto de clon de cDNA
Gene_bank_ref_id:BC130615
Tamaño de cDNA:1893bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens choline O-acetyltransferase with C terminal His tag.
Sinónimo de gen:CMS1A, CMS1A2, CHOACTASE
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CHAT qPCR primers for gene expression analysis, HP104341 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15748-ACG$245
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15748-ACR$245
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15748-ANG$245
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15748-ANR$245
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15748-CF$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15748-CH$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15748-CM$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15748-CY$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(Vector de expresión)HG15748-G$75
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15748-NF$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15748-NH$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15748-NM$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15748-NY$215
Humano Choline Acetyltransferase clonación del ADN o clonación génica(vector de clonación)HG15748-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15748-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"