After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CHMP4B Información de producto de clon de cDNA
Gene_bank_ref_id:BC033859
Tamaño de cDNA:675bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens charged multivesicular body protein 4B with C terminal His tag.
Sinónimo de gen:SNF7, CTPP3, Shax1, CHMP4A, SNF7-2, VPS32B, Vps32-2, C20orf178, dJ553F4.4, CHMP4B
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14022-ACG$225
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14022-ACR$225
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14022-ANG$225
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14022-ANR$225
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14022-CF$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14022-CH$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14022-CM$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14022-CY$195
Humano CHMP4B clonación del ADN o clonación génica(Vector de expresión)HG14022-G$75
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14022-NF$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14022-NH$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14022-NM$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14022-NY$195
Humano CHMP4B clonación del ADN o clonación génica(vector de clonación)HG14022-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14022-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"