Pedido rápido

Text Size:AAA

Humano CHMP4C clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CHMP4C Información de producto de clon de cDNA
    Gene_bank_ref_id:BC014321
    Tamaño de cDNA:702bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens charged multivesicular body protein 4C.
    Sinónimo de gen:MGC22825, SNF7-3, Shax3, VPS32C, CHMP4C
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHMP4C qPCR primers for gene expression analysis, HP102891 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14241-ACG$225
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14241-ACR$225
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14241-ANG$225
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14241-ANR$225
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14241-CF$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14241-CH$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14241-CM$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14241-CY$195
    Humano CHMP4C clonación del ADN o clonación génica(Vector de expresión)HG14241-G$75
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14241-NF$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14241-NH$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14241-NM$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14241-NY$195
    Humano CHMP4C clonación del ADN o clonación génica(vector de clonación)HG14241-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG14241-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"