Pedido rápido

Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CHST11 Información de producto de clon de cDNA
Tamaño de cDNA:1059bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11 with N terminal His tag.
Sinónimo de gen:C4ST, C4ST1, C4ST-1, HSA269537, CHST11
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11396-ACG$225
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11396-ACR$225
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11396-CF$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11396-CH$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11396-CM$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11396-CY$195
Humano CHST11 Gene cDNA clone plasmidHG11396-M$75
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11396-M-F$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11396-NF$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11396-NH$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11396-NM$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11396-NY$195
Humano CHST11 / C4ST-1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG11396-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving CHST11 gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia.

  • Hiraoka N. et al., 2000, J Biol Chem. 275 (26): 20188-96.
  • Schmidt HH. et al., 2004, Oncogene. 23 (41): 6991-6.
  • Okuda T. et al., 2001, J Biochem. 128 (5): 763-70.
  • Size / Price
    Catálogo: HG11396-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.