Pedido rápido

Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CLEC4M Información de producto de clon de cDNA
Tamaño de cDNA:1200bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member M with N terminal Flag tag.
Sinónimo de gen:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10559-ACG$225
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10559-ACR$225
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10559-CF$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10559-CH$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10559-CM$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10559-CY$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(Vector de expresión)HG10559-M$75
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10559-M-F$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación)HG10559-M-N$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10559-NF$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10559-NH$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10559-NM$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10559-NY$195
Humano DC-SIGNR/CD299 clonación del ADN o clonación génica(vector de clonación)HG10559-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Catálogo: HG10559-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.