Pedido rápido

Humano CLIC1/NCC27 clonación del ADN o clonación génica(vector de clonación)

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Hoja de datosReseñasProductos relacionadosProtocolos
Humano CLIC1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC064527
Tamaño de cDNA:726bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens chloride intracellular channel 1 DNA.
Sinónimo de gen:G6, NCC27
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CLIC1
Sitio de restricción:KpnI + XbaI(6.1kb+0.73kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CLIC1 qPCR primers for gene expression analysis, HP103868 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: HG15242-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"