After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano CNPY4 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CNPY4 Información de producto de clon de cDNA
Tamaño de cDNA:747bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens canopy 4 homolog (zebrafish) with N terminal Flag tag.
Sinónimo de gen:PRAT4B, CNPY4
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.

  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • Size / Price
    Catálogo: HG13355-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.