After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human COL4A3BP Información de producto de clon de cDNA
Gene_bank_ref_id:BC000102
Tamaño de cDNA:1797bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein with N terminal Myc tag.
Sinónimo de gen:CERT, CERTL, FLJ20597, GPBP, STARD11, COL4A3BP
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14306-ACG$245
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14306-ACR$245
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14306-ANG$245
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14306-ANR$245
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14306-CF$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14306-CH$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14306-CM$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14306-CY$215
Humano COL4A3BP clonación del ADN o clonación génica(Vector de expresión)HG14306-G$75
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14306-NF$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14306-NH$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14306-NM$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14306-NY$215
Humano COL4A3BP clonación del ADN o clonación génica(vector de clonación)HG14306-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.

Referencias
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
  • Size / Price
    Catálogo: HG14306-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"