Pedido rápido

Text Size:AAA

Humano COL5A2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human COL5A2 Información de producto de clon de cDNA
Tamaño de cDNA:4500bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens collagen, type V, alpha 2 with N terminal His tag.
Sinónimo de gen:COL5A2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

COL5A2 is a component of type V collagen. It is known as the pro-alpha2(V) chain. COL5A2, together with two pro-alpha1(V) chains can form type V procollagen. These triple-stranded, rope-like procollagen molecules arrange themselves into long, thin fibrils that cross-link to one another in the spaces around cells. The cross-links result in the formation of very strong, mature type V collagen fibers. Type V collagen can be detected in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen.

  • Greenspan DS. et al., 1992, Genomics. 12 (4): 836-7.
  • Mann K. 1992, Biol Chem Hoppe-Seyler. 373 (2): 69-75.
  • Greenspan DS. et al., 1992, Gene Expr. 1 (1): 29-39.
  • Size / Price
    Catálogo: HG13685-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.