Pedido rápido

Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano COMMD10 Información de producto de clon de cDNA
Gene_bank_ref_id:BC005179
Tamaño de cDNA:609bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens COMM domain containing 10 with C terminal His tag.
Sinónimo de gen:PTD002, COMMD10
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with COMMD10 qPCR primers for gene expression analysis, HP102664 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14008-ACG$225
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14008-ACR$225
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14008-ANG$225
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14008-ANR$225
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14008-CF$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14008-CH$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14008-CM$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14008-CY$195
Humano COMMD10 clonación del ADN o clonación génica(Vector de expresión)HG14008-G$75
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14008-NF$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14008-NH$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14008-NM$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14008-NY$195
Humano COMMD10 clonación del ADN o clonación génica(vector de clonación)HG14008-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"