After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human COPE Información de producto de clon de cDNA
Gene_bank_ref_id:BC003155
Tamaño de cDNA:927bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens coatomer protein complex, subunit epsilon.
Sinónimo de gen:FLJ13241, epsilon-COP, COPE
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14265-ACG$225
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14265-ACR$225
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14265-ANG$225
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14265-ANR$225
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14265-CF$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14265-CH$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14265-CM$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14265-CY$195
Humano epsilon-COP clonación del ADN o clonación génica(Vector de expresión)HG14265-G$75
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14265-NF$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14265-NH$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14265-NM$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14265-NY$195
Humano epsilon-COP clonación del ADN o clonación génica(vector de clonación)HG14265-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14265-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"