Pedido rápido

Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano CPA1 Información de producto de clon de cDNA
Tamaño de cDNA:1260bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens carboxypeptidase A1 (pancreatic) with C terminal HA tag.
Sinónimo de gen:CPA
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
( We provide with CPA1 qPCR primers for gene expression analysis, HP100525 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10504-ACG$225
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10504-ACR$225
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10504-CF$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10504-CH$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10504-CM$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10504-CY$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(Vector de expresión)HG10504-M$75
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10504-NF$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10504-NH$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10504-NM$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10504-NY$195
Humano Carboxypeptidase A1/CPA1 clonación del ADN o clonación génica(vector de clonación)HG10504-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Catálogo: HG10504-CY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.