Pedido rápido

Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CPA2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001869.2
    Tamaño de cDNA:1254bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens carboxypeptidase A2 (pancreatic) with N terminal HA tag.
    Sinónimo de gen:CPA2
    Especie:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPA2 qPCR primers for gene expression analysis, HP100520 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10499-ACG$225
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10499-ACR$225
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10499-CF$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10499-CH$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10499-CM$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10499-CY$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(Vector de expresión)HG10499-M$75
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10499-NF$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10499-NH$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10499-NM$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10499-NY$195
    Humano Carboxypeptidase A2/CPA2 clonación del ADN o clonación génica(vector de clonación)HG10499-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

    Referencias
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catálogo: HG10499-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"