After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano CRELD1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CRELD1 Información de producto de clon de cDNA
Tamaño de cDNA:1263bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cysteine-rich with EGF-like domains 1 with C terminal His tag.
Sinónimo de gen:AVSD2, CIRRIN, CRELD1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)­like domain exists in CRELD1. EGF-like repeats are a class of cysteine-rich domains that mediate interactions between proteins of diverse function. EGF domains are found in proteins that are either completely secreted or have transmembrane regions that tether the protein to the cell surface. CRELD1 contains a 333 amino acid acid (aa) extracellular domain (ECD), two tandem transmembrane segments, and a second ECD of 15 aa. Defects in CRELD1 may cause susceptibility to atrioventricular septal defect type 2 which results in a persistent common atrioventricular canal.

  • Robinson SW, et al. (2003) Missense Mutations in CRELD1 Are Associated with Cardiac Atrioventricular Septal Defects. Am J Hum Genet. 72(4):1047-52.
  • Zatyka M, et al. (2005) Analysis of CRELD1 as a candidate 3p25 atrioventicular septal defect locus (AVSD2). Clin Genet. 67(6):526-8.
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Size / Price
    Catálogo: HG13411-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.