Pedido rápido

Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CSK Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001127190.1
Tamaño de cDNA:1353bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens c-src tyrosine kinase with N terminal His tag.
Sinónimo de gen:MGC117393, CSK
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10740-ACG$225
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10740-ACR$225
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10740-ANG$225
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10740-ANR$225
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10740-CF$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10740-CH$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10740-CM$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10740-CY$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(Vector de expresión)HG10740-M$75
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10740-NF$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10740-NH$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10740-NM$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10740-NY$195
Humano C-Src Kinase / CSK clonación del ADN o clonación génica(vector de clonación)HG10740-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

References

Referencias
  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.
  • Size / Price
    Catálogo: HG10740-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"