After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CSNK1A1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001892.4
Tamaño de cDNA:1014bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Sinónimo de gen:CK1, HLCDGP1, PRO2975, CSNK1A1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Sitio de restricción:KpnI + XbaI (6.1kb + 1.01kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10668-ACG$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10668-ACR$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10668-ANG$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10668-ANR$225
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10668-CF$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10668-CH$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10668-CM$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10668-CY$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(Vector de expresión)HG10668-M$75
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10668-M-F$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10668-NF$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10668-NH$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10668-NM$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10668-NY$195
Humano CSNK1A1/Casein Kinase 1, alpha 1 clonación del ADN o clonación génica(vector de clonación)HG10668-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Referencias
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Catálogo: HG10668-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"