After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CSRP1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CSRP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004078.2
Tamaño de cDNA:582bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cysteine and glycine-rich protein 1.
Sinónimo de gen:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CSRP1
Sitio de restricción:HindIII + XbaI (6.1kb + 0.58kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CSRP1 Gene Plasmid Map
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11201-ACG$225
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11201-ACR$225
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11201-ANG$225
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11201-ANR$225
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11201-CF$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11201-CH$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11201-CM$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11201-CY$195
Humano CSRP1 clonación del ADN o clonación génica(Vector de expresión)HG11201-M$75
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11201-M-F$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11201-NF$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11201-NH$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11201-NM$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11201-NY$195
Humano CSRP1 clonación del ADN o clonación génica(vector de clonación)HG11201-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

Referencias
  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    Catálogo: HG11201-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"