CT45A3 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CT45A3 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Human cancer/testis antigen family 45, member A3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CT45A3 cDNA ORF Clone, Human, C-HA tag: Alternative Names

CT45-3 cDNA ORF Clone, Human; CT45-4 cDNA ORF Clone, Human; CT45.3 cDNA ORF Clone, Human; CT45.4 cDNA ORF Clone, Human

CT45A3 Background Information

Full Name
cancer/testis antigen family 45, member A3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait