Pedido rápido

Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CTCFL Información de producto de clon de cDNA
Tamaño de cDNA:1992bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens CCCTC-binding factor (zinc finger protein)-like with C terminal His tag.
Sinónimo de gen:CT27, BORIS, CTCF-T, HMGB1L1, dJ579F20.2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15751-ACG$245
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15751-ACR$245
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15751-ANG$245
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15751-ANR$245
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15751-CF$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15751-CH$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15751-CM$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15751-CY$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(Vector de expresión)HG15751-G$75
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15751-NF$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15751-NH$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15751-NM$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15751-NY$215
Humano CTCFL/BORIS clonación del ADN o clonación génica(vector de clonación)HG15751-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15751-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.