Pedido rápido

Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CTLA4 Información de producto de clon de cDNA
Tamaño de cDNA:654bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cytotoxic T-lymphocyte-associated protein 4, transcript variant 1 with C terminal HA tag.
Sinónimo de gen:GSE, CD152, CTLA-4, IDDM12, CELIAC3, CTLA4
Sitio de restricción:KpnI + XbaI (6kb + 0.7kb)
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CTLA4 Gene Plasmid Map
Human CTLA4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11159-ACG$225
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11159-ACR$225
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11159-CF$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11159-CH$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11159-CM$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11159-CY$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11159-G$75
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11159-NF$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11159-NH$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11159-NM$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11159-NY$195
Humano CTLA-4/CD152 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11159-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • Size / Price
    Catálogo: HG11159-CY
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human CTLA4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.