After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CUL5 Información de producto de clon de cDNA
Gene_bank_ref_id:BC063306
Tamaño de cDNA:2343bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cullin 5.
Sinónimo de gen:VACM1, VACM-1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15203-ACG$245
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15203-ACR$245
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15203-ANG$245
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15203-ANR$245
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15203-CF$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15203-CH$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15203-CM$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15203-CY$215
Humano Cullin 5 clonación del ADN o clonación génica(Vector de expresión)HG15203-G$75
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15203-NF$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15203-NH$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15203-NM$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15203-NY$215
Humano Cullin 5 clonación del ADN o clonación génica(vector de clonación)HG15203-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15203-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"