Pedido rápido

Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CYP1A1 Información de producto de clon de cDNA
Tamaño de cDNA:1539bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 with C terminal His tag.
Sinónimo de gen:P450DX, P1-450, P450-C, CP11
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12053-ACG$245
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12053-ACR$245
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12053-ANG$245
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12053-ANR$245
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12053-CF$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12053-CH$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12053-CM$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12053-CY$215
Humano CYP1A1 clonación del ADN o clonación génica(Vector de expresión)HG12053-G$75
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12053-NF$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12053-NH$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12053-NM$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12053-NY$215
Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación)HG12053-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12053-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.