Pedido rápido

Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CYP1A1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_000499
    Tamaño de cDNA:1539bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 with C terminal His tag.
    Sinónimo de gen:P450DX, P1-450, P450-C, CP11
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CYP1A1 qPCR primers for gene expression analysis, HP101585 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12053-ACG$245
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12053-ACR$245
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12053-ANG$245
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12053-ANR$245
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12053-CF$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12053-CH$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12053-CM$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12053-CY$215
    Humano CYP1A1 clonación del ADN o clonación génica(Vector de expresión)HG12053-G$75
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12053-NF$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12053-NH$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12053-NM$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12053-NY$215
    Humano CYP1A1 clonación del ADN o clonación génica(vector de clonación)HG12053-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG12053-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"