Pedido rápido

Text Size:AAA

Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CYP1B1 Información de producto de clon de cDNA
Tamaño de cDNA:1632bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide 1 with N terminal His tag.
Sinónimo de gen:CP1B, GLC3A, CYPIB1, P4501B1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14853-ACG$245
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14853-ACR$245
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14853-ANG$245
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14853-ANR$245
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14853-CF$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14853-CH$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14853-CM$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14853-CY$215
Humano CYP1B1 clonación del ADN o clonación génica(Vector de expresión)HG14853-G$75
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14853-NF$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14853-NH$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14853-NM$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14853-NY$215
Humano CYP1B1 clonación del ADN o clonación génica(vector de clonación)HG14853-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14853-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.