After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CYP2C18 Información de producto de clon de cDNA
Gene_bank_ref_id:BC069666
Tamaño de cDNA:1473bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 18 with N terminal His tag.
Sinónimo de gen:CPCI, CYP2C, CYP2C17, P450IIC17, P450-6B/29C
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15382-ACG$225
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15382-ACR$225
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15382-ANG$225
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15382-ANR$225
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15382-CF$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15382-CH$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15382-CM$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15382-CY$195
Humano CYP2C18 clonación del ADN o clonación génica(Vector de expresión)HG15382-G$75
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15382-NF$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15382-NH$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15382-NM$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15382-NY$195
Humano CYP2C18 clonación del ADN o clonación génica(vector de clonación)HG15382-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15382-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"