After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CYP2D6 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000106.4
Tamaño de cDNA:1494bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Sinónimo de gen:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Sitio de restricción:KpnI + XbaI (6.1kb + 1.49kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12022-ACG$225
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12022-ACR$225
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12022-ANG$225
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12022-ANR$225
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12022-CF$195
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12022-CH$215
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12022-CM$215
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12022-CY$215
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(Vector de expresión)HG12022-G$75
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12022-NF$195
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12022-NH$195
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12022-NM$195
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12022-NY$195
Humano CYP2D6/Cytochrome P450 2D6 clonación del ADN o clonación génica(vector de clonación)HG12022-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12022-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"