After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human CAMK4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001744.4
Tamaño de cDNA:1422bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
Sinónimo de gen:CaMK-GR, MGC36771, CAMK4
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10664-ACG$225
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10664-ACR$225
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10664-ANG$225
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10664-ANR$225
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10664-CF$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10664-CH$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10664-CM$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10664-CY$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(Vector de expresión)HG10664-M$75
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10664-M-F$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)HG10664-M-N$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10664-NF$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10664-NH$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10664-NM$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10664-NY$195
Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)HG10664-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

Referencias
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catálogo: HG10664-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"