Pedido rápido

Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CAMK4 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001744.4
    Tamaño de cDNA:1422bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
    Sinónimo de gen:CaMK-GR, MGC36771, CAMK4
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAMK4 qPCR primers for gene expression analysis, HP100632 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10664-ACG$225
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10664-ACR$225
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10664-ANG$225
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10664-ANR$225
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10664-CF$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10664-CH$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10664-CM$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10664-CY$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(Vector de expresión)HG10664-M$75
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10664-M-F$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)HG10664-M-N$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10664-NF$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10664-NH$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10664-NM$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10664-NY$195
    Humano CaM Kinase 4/CaMKIV clonación del ADN o clonación génica(vector de clonación)HG10664-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

    Referencias
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catálogo: HG10664-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"